Review




Structured Review

Bio-Rad tris hcl
Tris Hcl, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 22183 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/Tris/10__22203_slash_ecm__v033a11-129-21-16
Average 98 stars, based on 22183 article reviews
tris hcl - by Bioz Stars, 2026-09
98/100 stars

Images

Related Articles

Buffer Exchange:

Article Title: Molecular insights into model polyester-based polyurethane impranil DLN degradation by TfCut2 cutinase.
Article Snippet: The enzymatic degradation of synthetic polymers offers a sustainable route for plastic waste recycling, yet progress remains limited by an incomplete understanding of enzyme–polymer recognition and catalytic mechanisms.. While cutinases have shown potential to degrade polyester-based polyurethanes (PURs), the molecular determinants of substrate binding and selectivity are still poorly resolved.. In this study, we combined computational and experimental approaches to elucidate the interaction between Thermobifida fusca cutinase (TfCut2) and Impranil DLN, a polyester-based PUR widely used as a model substrate.

Incubation:

Article Title: A chlorhexidine-releasing epoxy-based coating on titanium implants prevents Staphylococcus aureus experimental biomaterial-associated infection
Article Snippet: The sections were subjected to heatinduced epitope retrieval (HIER) (van der Loos, 2010), performed in a PreTreatment Module (Lab Vision) by incubation in citrate buffer pH 6.0 (TA-250-PM1X, Thermo Fisher Scientific) for 20 min at 98 °C, rinsed with tap water and incubated with Superblock (AAA999, Klinipath) for 10 min at RT. .. Sections were incubated overnight at 4 °C with rat anti-mouse monoclonal F4/80 (macrophages; MCA497GA, clone: CI:A3-1, Serotec) diluted 1: 1000 in Tris-HCl-buffered saline (TBS; 50 mM Tris, 0.9 % NaCl), subsequently with rabbit anti-rat IgG (6130-01, fab2; SBA/ITK) diluted 1: 3000 in TBS with 20 % normal mouse serum for 30 min at RT, followed by undiluted BrightVision anti-rabbit AP (DPVB-55AP, Immunologic) for 30 min at RT and finally with Vector Blue (SK-5300, Vector Labs) for 10 min at RT, with three TBS washes between all incubations. ..

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications.
Article Snippet: .. To confirm the presence and integrity of GST and GST-LiGP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 ◦C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have LiGP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding LiGP63m was cloned into the pColdTM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications
Article Snippet: .. To confirm the presence and integrity of GST and GST- Li GP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 °C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have Li GP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding Li GP63m was cloned into the pCold TM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).

Saline:

Article Title: A chlorhexidine-releasing epoxy-based coating on titanium implants prevents Staphylococcus aureus experimental biomaterial-associated infection
Article Snippet: The sections were subjected to heatinduced epitope retrieval (HIER) (van der Loos, 2010), performed in a PreTreatment Module (Lab Vision) by incubation in citrate buffer pH 6.0 (TA-250-PM1X, Thermo Fisher Scientific) for 20 min at 98 °C, rinsed with tap water and incubated with Superblock (AAA999, Klinipath) for 10 min at RT. .. Sections were incubated overnight at 4 °C with rat anti-mouse monoclonal F4/80 (macrophages; MCA497GA, clone: CI:A3-1, Serotec) diluted 1: 1000 in Tris-HCl-buffered saline (TBS; 50 mM Tris, 0.9 % NaCl), subsequently with rabbit anti-rat IgG (6130-01, fab2; SBA/ITK) diluted 1: 3000 in TBS with 20 % normal mouse serum for 30 min at RT, followed by undiluted BrightVision anti-rabbit AP (DPVB-55AP, Immunologic) for 30 min at RT and finally with Vector Blue (SK-5300, Vector Labs) for 10 min at RT, with three TBS washes between all incubations. ..

other:

Article Title: Oligomerization-dependent and synergistic regulation of Cdc42 GTPase cycling by a GEF and a GAP
Article Snippet: In brief, a solution of 375 mM Tris-HCl (pH = 8.8), 30–37.5 v/v% 40% acrylamide solution (Bio-Rad), 0.2 w/v% sodium dodecyl sulfate (Sigma-Aldrich), 0.5 v/v% 2,2,2-Trichloroethanol (Sigma-Aldrich), 0.1 w/v% ammonium persulfate (Sigma-Aldrich), and 0.1 v/v% N,N,N’,N’-tetramethyl ethylenediamine (Sigma-Aldrich) was prepared and casted into 1.00 mm mini-protean glass plates (Bio-Rad), filling them up to 80%.

Nucleic Acid Electrophoresis:

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications.
Article Snippet: .. To confirm the presence and integrity of GST and GST-LiGP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 ◦C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have LiGP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding LiGP63m was cloned into the pColdTM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications
Article Snippet: .. To confirm the presence and integrity of GST and GST- Li GP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 °C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have Li GP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding Li GP63m was cloned into the pCold TM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).

Staining:

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications.
Article Snippet: .. To confirm the presence and integrity of GST and GST-LiGP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 ◦C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have LiGP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding LiGP63m was cloned into the pColdTM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).

Article Title: Development of DNA Aptamers Against Leishmania infantum GP63 Protein for Therapeutic and Diagnostic Applications
Article Snippet: .. To confirm the presence and integrity of GST and GST- Li GP63m, 10 μL of protein-carrying beads was incubated for 5 min at 95 °C diluted in Laemmli solution (0.14 M sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 3 mM bromophenol blue, 0.125 M tris-HCl, pH 6.8) and resolved in a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE; Mini Protean II System, Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with Coomassie blue. .. To obtain larger protein amounts for binding affinity characterization, and to have Li GP63m with a tag different from GST in order to confirm aptamer specificity, the gene encoding Li GP63m was cloned into the pCold TM TF DNA plasmid (Takara Bio, Kusatsu, Japan), using the InFusion cloning system, to obtain a 6× histidine-tagged protein (forward and reverse primers used were 5′TACCCTCGAGGGATCCGTCGTGCGCGCCGCGAACTGG3′ and 5′TAGACTGCAGGTCGACGTTGCCGCCGTCCTTGGC3′, respectively).



Similar Products

98
Bio-Rad tris hcl
Tris Hcl, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/Tris/10__22203_slash_ecm__v033a11-129-21-16
Average 98 stars, based on 1 article reviews
tris hcl - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

99
Thermo Fisher tris hcl
Tris Hcl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/TRIS-HCL/10__22175_slash_mmb__17760-100-16-35
Average 99 stars, based on 1 article reviews
tris hcl - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Brickell Biotech tris hcl buffer
Tris Hcl Buffer, supplied by Brickell Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/buffer+hcl+tris/pmc13273213-54-3-19
Average 86 stars, based on 1 article reviews
tris hcl buffer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech tris hcl solution ph 7 4
Tris Hcl Solution Ph 7 4, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/hcl+tris/pmc13202259-24-0-5
Average 86 stars, based on 1 article reviews
tris hcl solution ph 7 4 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

98
Thermo Fisher 1m solution
1m Solution, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/Tris-HCl%2C+1M+Solution%2C+pH+8%2E0%2C+Molecular+Biology+Grade%2C+Ultrapure/pmc13255032-114-1-6
Average 98 stars, based on 1 article reviews
1m solution - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

99
Thermo Fisher neutralization buffer
Neutralization Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/TRIS-HCL/pmc13049938-285-6-29
Average 99 stars, based on 1 article reviews
neutralization buffer - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Thermo Fisher bis tris gels
Bis Tris Gels, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tris+hcl/TRIS-HCL/pmc12863304-231-13-15
Average 99 stars, based on 1 article reviews
bis tris gels - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results